View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16926_low_21 (Length: 202)

Name: NF16926_low_21
Description: NF16926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16926_low_21
NF16926_low_21
[»] chr4 (1 HSPs)
chr4 (1-47)||(53562538-53562584)


Alignment Details
Target: chr4 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 53562538 - 53562584
Alignment:
1 cttatgctttctgtgttgctgctctgcgtgttctgctgtatgcatca 47  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||    
53562538 cttatgctttctgtgttgctgctctgcgtgttttgctgtatgcatca 53562584  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University