View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16927_high_3 (Length: 502)
Name: NF16927_high_3
Description: NF16927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16927_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 401; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 401; E-Value: 0
Query Start/End: Original strand, 17 - 486
Target Start/End: Original strand, 28829336 - 28829789
Alignment:
| Q |
17 |
aatctcatagaaaatatttcccaaaaattctattgacaaaatcaacacaacccttttctttcttattcatttgattctttcaaagttgtcacaaactttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
28829336 |
aatctcatagaaaatatttcccaaaaattctattgacaaaatcaacacaacccttttctttcttattc----------------gttgtcgcaaactttt |
28829419 |
T |
 |
| Q |
117 |
tgtgccaattaatctcaatgggtgtgaaaggtttcgtcgaaggaggcatagcttccatcattgcagggtgttcaacacaccctcttgatctcatcaaggt |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829420 |
tgtgccaattaatcgcaatgggtgtgaaaggtttcgtcgaaggaggcatagcttccatcattgcagggtgttcaacacaccctcttgatctcatcaaggt |
28829519 |
T |
 |
| Q |
217 |
tcgaatgcagcttcaaggagagaatgctcctacaaccaatatccgaccagcattagctttccaacccggttcggttcatcggtcaccggcggtgacggcc |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
28829520 |
tcgaatgcagcttcaaggagagaatgctcctacaaccaatatccgaccagcattagctttccaacccggttcggttcatcggtcaccagcggtgacggcc |
28829619 |
T |
 |
| Q |
317 |
caaccgccccgtgttgggccgatcgccgttggtgttaagctagtccagcaagaaggtgtagcagcacttttctccggtgtctctgccaccgttctccggc |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829620 |
caaccgccccgtgttgggccgatcgccgttggtgttaagctagtccaacaagaaggtgtagcagcacttttctccggtgtctctgccaccgttctccggc |
28829719 |
T |
 |
| Q |
417 |
agtgtctctattccaccactcgtatgggactctatgatatgatgaagaaaaaatggtctgatcctatctc |
486 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28829720 |
agtgtctctattccaccactcgtatgggactctatgatatgatgaagaaaaaatggtctgatcctatctc |
28829789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University