View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16927_low_10 (Length: 252)
Name: NF16927_low_10
Description: NF16927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16927_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 45294497 - 45294273
Alignment:
| Q |
18 |
tacttcttcttctgtctctttgatttcgatcaaaaactcctctaccttttacagttagacnnnnnnnnnnnnnngctagtgagaaagagaggttttgcaa |
117 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
45294497 |
tacttcttcttctgtctctttgatttcaatcaaaaactcctctaccttttacagttagacaaaaaaagaaaaaagctagtgagaaagagaggttttgcaa |
45294398 |
T |
 |
| Q |
118 |
aagagtgattgtcacatttattgatcaaataggtgagtacattttgagctaagattctctctctatcttctaactccttgatgtagagtttgttttctgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45294397 |
aagagtgattgtcacatttattgatcaaataggtgagtacattttgagctaagattctctctctatcttctaactccttgatgtagagtttgttttctgc |
45294298 |
T |
 |
| Q |
218 |
aatctctttggtttgtttctctgtg |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45294297 |
aatctctttggtttgtttctctgtg |
45294273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University