View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16927_low_12 (Length: 237)
Name: NF16927_low_12
Description: NF16927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16927_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 26297811 - 26297900
Alignment:
| Q |
1 |
tcatcatcacttgtttagcaagaaatcttcaacatttaagttttataagtagaaaatcttcaacgtttattctacttgatttatgtattt |
90 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26297811 |
tcatcatcacttgtttaacaagaaatcttcaacatttaagttttataagtagaaaatcttcaacatttattctacttgatttatgtattt |
26297900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 87 - 167
Target Start/End: Original strand, 26298452 - 26298532
Alignment:
| Q |
87 |
attttatcacataaactcaaaaccaaagtttcataggtagttataaataatataaaaaatgggtgcatgtttgtcttgagc |
167 |
Q |
| |
|
|||| |||||||||||||||| |||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
26298452 |
atttaatcacataaactcaaatccaaagttacataggtagttataaataatctaaaaaatgggtgcaagtttgtcttgagc |
26298532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University