View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16928_high_12 (Length: 260)
Name: NF16928_high_12
Description: NF16928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16928_high_12 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 31811343 - 31811084
Alignment:
| Q |
1 |
tcactgctgcagccatagcagctgatgaatcaaatccaaatggtgatgattttctcataggagatgaaacaatgttgttgaatggataacttgcttgaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31811343 |
tcactgctgcagccatagcagctgatgaatcaaatccaaatggtgatgattttctcataggagatgaaacaatgttgttgaatggataacttgcttgaac |
31811244 |
T |
 |
| Q |
101 |
atggttcctattttggttcagctgaagcctactcatagattgaaattggctaggagttgaaggttgcattgaaacaccatgtaacaggtccatttcttga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31811243 |
atggttcctattttggttcagctgaagcctactcatagattgaaattggctaggagttgaaggttgcattgaaacaccatgtaacaggtccatttcttga |
31811144 |
T |
 |
| Q |
201 |
tacaaatcccttgcactcatagcatttttcagctgcaatgaaggtggagtgagattgatt |
260 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31811143 |
tacaaatcccttgcactcaaagcatttttcagctgcaatgaaggtggagtgagattgatt |
31811084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University