View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16928_high_15 (Length: 243)
Name: NF16928_high_15
Description: NF16928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16928_high_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 8919678 - 8919448
Alignment:
| Q |
1 |
caataaccgatgtatttaaactatcatacagttcacaaacatcaattattcaataaatctgaagnnnnnnnnnnttgtttatagtaatgatcggaacaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| |||| ||||||||||||||||| |||| ||| |
|
|
| T |
8919678 |
caataaccgatgtatttaaactatcatacggttcacaaacatcaattattcaatgaatttgaa-----aaaaaattgtttatagtaatgataggaataaa |
8919584 |
T |
|
| Q |
101 |
taaagacaatgggaatgtggacataaattgtttagctttgtt--------ggatgcccaaacgaggatattggctctagttagagtctcgttaatatgac |
192 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||| | ||||||||||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
8919583 |
taaagacaatgggaatgtggaaataaattgtttagctttgtttctctgttgcatgcccaaacgaggatattggctctagatagggtctcgtttatatgac |
8919484 |
T |
|
| Q |
193 |
gatttgaactttttgtgaaaatgatagttaaaaaat |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8919483 |
gatttgaactttttgtgaaaatgatagttaaaaaat |
8919448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University