View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16928_high_16 (Length: 229)
Name: NF16928_high_16
Description: NF16928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16928_high_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 32012421 - 32012633
Alignment:
| Q |
1 |
ttttggtagcaactgcagttgaggctgagggtgatgaggatgtgatgcagcagaaccgagacctggttgttcagacatatctactttacttggttgacat |
100 |
Q |
| |
|
||||| |||||||||||| ||||| |||||||||| | ||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32012421 |
ttttgatagcaactgcagatgaggttgagggtgatcaagatatgatgtagcagaaccgagacctggttgttcagacatatctgctttacttggttgacat |
32012520 |
T |
 |
| Q |
101 |
cacactcttcactaacaagagcgccacctatgttgatatggcatacctgaaatacgtatgtgaccttgaactggtcagcaattatgcat-gagagaggtt |
199 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||| | |||||||| |
|
|
| T |
32012521 |
cacactcttcactaacaatagtgccacctatgttgatgtggcatacctgaaatacgtctgtgaccttgaactagtcagcaattatgcatggggagaggtt |
32012620 |
T |
 |
| Q |
200 |
gatcttgctcact |
212 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32012621 |
gatcttgctcact |
32012633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 137
Target Start/End: Complemental strand, 45054168 - 45054118
Alignment:
| Q |
87 |
tacttggttgacatcacactcttcactaacaagagcgccacctatgttgat |
137 |
Q |
| |
|
|||||||| | |||||| ||||| ||| ||||||||||||||||||||||| |
|
|
| T |
45054168 |
tacttggtgggcatcactctctttactgacaagagcgccacctatgttgat |
45054118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 192
Target Start/End: Original strand, 29957485 - 29957577
Alignment:
| Q |
100 |
tcacactcttcactaacaagagcgccacctatgttgatatggcatacctgaaatacgtatgtgaccttgaactggtcagcaattatgcatgag |
192 |
Q |
| |
|
|||||||||| | | ||||||| ||||||| ||||||| || |||||| || ||| ||||||||||| | |||||| | |||||||||||| |
|
|
| T |
29957485 |
tcacactctttattgacaagagtgccacctttgttgatgtgatatacctcaagtacttatgtgaccttaagttggtcaaccattatgcatgag |
29957577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 136
Target Start/End: Original strand, 26184330 - 26184378
Alignment:
| Q |
88 |
acttggttgacatcacactcttcactaacaagagcgccacctatgttga |
136 |
Q |
| |
|
||||||| |||||||| |||||| ||||||||||| |||||| |||||| |
|
|
| T |
26184330 |
acttggtggacatcactctcttctctaacaagagcaccacctttgttga |
26184378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University