View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16928_low_14 (Length: 279)
Name: NF16928_low_14
Description: NF16928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16928_low_14 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 17 - 208
Target Start/End: Complemental strand, 30849901 - 30849707
Alignment:
| Q |
17 |
acttatttttcacaacttagcgaaccaaggtttcaattccgtttaatnnnnnnncagaattgaattacgatatccgtgtggatgaaaccnnnnnnntatt |
116 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||| ||||||||||||| ||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
30849901 |
acttatttttcacaacttagtgaaccaatgtttgaattccgtttaataaaaaaa-agaattgaattccgatatccgtgtggatgaaaccaaaaaaatatt |
30849803 |
T |
|
| Q |
117 |
ataaaattaattgatatgacaata----accttattgtataattcattaaatattttcatgaatatttacgtaataaaatatgacagaagtcgtat |
208 |
Q |
| |
|
|||||||||||||||||||||||| | | |||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
30849802 |
ataaaattaattgatatgacaatactaaatgtcattggataattcattaaatattttcatgaatatctacgtaataaaatatgacagaagtcgtat |
30849707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University