View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16928_low_19 (Length: 243)

Name: NF16928_low_19
Description: NF16928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16928_low_19
NF16928_low_19
[»] chr6 (1 HSPs)
chr6 (1-228)||(8919448-8919678)


Alignment Details
Target: chr6 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 8919678 - 8919448
Alignment:
1 caataaccgatgtatttaaactatcatacagttcacaaacatcaattattcaataaatctgaagnnnnnnnnnnttgtttatagtaatgatcggaacaaa 100  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||| ||||           ||||||||||||||||| |||| |||    
8919678 caataaccgatgtatttaaactatcatacggttcacaaacatcaattattcaatgaatttgaa-----aaaaaattgtttatagtaatgataggaataaa 8919584  T
101 taaagacaatgggaatgtggacataaattgtttagctttgtt--------ggatgcccaaacgaggatattggctctagttagagtctcgttaatatgac 192  Q
    ||||||||||||||||||||| ||||||||||||||||||||        | ||||||||||||||||||||||||||| ||| |||||||| |||||||    
8919583 taaagacaatgggaatgtggaaataaattgtttagctttgtttctctgttgcatgcccaaacgaggatattggctctagatagggtctcgtttatatgac 8919484  T
193 gatttgaactttttgtgaaaatgatagttaaaaaat 228  Q
    ||||||||||||||||||||||||||||||||||||    
8919483 gatttgaactttttgtgaaaatgatagttaaaaaat 8919448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University