View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16928_low_20 (Length: 229)

Name: NF16928_low_20
Description: NF16928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16928_low_20
NF16928_low_20
[»] chr6 (1 HSPs)
chr6 (1-212)||(32012421-32012633)
[»] chr8 (1 HSPs)
chr8 (87-137)||(45054118-45054168)
[»] chr7 (1 HSPs)
chr7 (100-192)||(29957485-29957577)
[»] chr5 (1 HSPs)
chr5 (88-136)||(26184330-26184378)


Alignment Details
Target: chr6 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 32012421 - 32012633
Alignment:
1 ttttggtagcaactgcagttgaggctgagggtgatgaggatgtgatgcagcagaaccgagacctggttgttcagacatatctactttacttggttgacat 100  Q
    ||||| |||||||||||| ||||| |||||||||| | ||| ||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||    
32012421 ttttgatagcaactgcagatgaggttgagggtgatcaagatatgatgtagcagaaccgagacctggttgttcagacatatctgctttacttggttgacat 32012520  T
101 cacactcttcactaacaagagcgccacctatgttgatatggcatacctgaaatacgtatgtgaccttgaactggtcagcaattatgcat-gagagaggtt 199  Q
    |||||||||||||||||| || ||||||||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||| | ||||||||    
32012521 cacactcttcactaacaatagtgccacctatgttgatgtggcatacctgaaatacgtctgtgaccttgaactagtcagcaattatgcatggggagaggtt 32012620  T
200 gatcttgctcact 212  Q
    |||||||||||||    
32012621 gatcttgctcact 32012633  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 137
Target Start/End: Complemental strand, 45054168 - 45054118
Alignment:
87 tacttggttgacatcacactcttcactaacaagagcgccacctatgttgat 137  Q
    |||||||| | |||||| ||||| ||| |||||||||||||||||||||||    
45054168 tacttggtgggcatcactctctttactgacaagagcgccacctatgttgat 45054118  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 100 - 192
Target Start/End: Original strand, 29957485 - 29957577
Alignment:
100 tcacactcttcactaacaagagcgccacctatgttgatatggcatacctgaaatacgtatgtgaccttgaactggtcagcaattatgcatgag 192  Q
    |||||||||| | | ||||||| ||||||| ||||||| ||  |||||| || ||| ||||||||||| |  |||||| | ||||||||||||    
29957485 tcacactctttattgacaagagtgccacctttgttgatgtgatatacctcaagtacttatgtgaccttaagttggtcaaccattatgcatgag 29957577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 88 - 136
Target Start/End: Original strand, 26184330 - 26184378
Alignment:
88 acttggttgacatcacactcttcactaacaagagcgccacctatgttga 136  Q
    ||||||| |||||||| |||||| ||||||||||| |||||| ||||||    
26184330 acttggtggacatcactctcttctctaacaagagcaccacctttgttga 26184378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University