View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16928_low_21 (Length: 227)
Name: NF16928_low_21
Description: NF16928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16928_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 76 - 212
Target Start/End: Original strand, 45450086 - 45450222
Alignment:
| Q |
76 |
ttctccaacacataattgatcaacccagtccatggtcaagtgaatctaaaaggctagatatttatcccatgctggaaaaatggaaattaaggaagatctt |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
45450086 |
ttctccaacacataattgatcaacccagtccatggtcatgtgaatctagaaggctagatatttatcccatgctggaaaaatggaaattacggaagatctt |
45450185 |
T |
 |
| Q |
176 |
ttctaaaataatagaactacagtacacggcatctctg |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45450186 |
ttctaaaataatagaactacagtacacggcatctctg |
45450222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 16 - 59
Target Start/End: Original strand, 45450023 - 45450066
Alignment:
| Q |
16 |
atcccaactcgtccaagtatattactaatttgattatttcctac |
59 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45450023 |
atcctaactcgtccaagtatattactaatttgattatttcctac |
45450066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University