View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16928_low_22 (Length: 205)
Name: NF16928_low_22
Description: NF16928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16928_low_22 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 187
Target Start/End: Complemental strand, 33014758 - 33014590
Alignment:
| Q |
19 |
aatattctaagaaatcttttgaatatcccgccaaatgaacaaatattgcttcataaaggaaaaaattgcaactatagtaataagtttagtgtaattgcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33014758 |
aatattctaagaaatcttttgaatatcccgccaaatgaacaaatattgcttcataaaggaaaaaattgcaactatagtaataagtttagtgtaattgcaa |
33014659 |
T |
|
| Q |
119 |
ctaattaatacaaaaaatggcatgtaattagttagggttaggcccattaatttgaacttagttcttttt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33014658 |
ctaattaatacaaaaaatggcatgtaattagttagggttaggcccattaatttgaacttagttcttttt |
33014590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University