View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16928_low_8 (Length: 371)
Name: NF16928_low_8
Description: NF16928
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16928_low_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 23 - 354
Target Start/End: Complemental strand, 18323848 - 18323517
Alignment:
| Q |
23 |
acacaaacacttcttgtttgtcttgagaagtgttttgagaccatcacaacaatctggtgctggagtttttccttcaccttcaacatagggaaggcatgat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
18323848 |
acacaaacacttcttgtttgtcttgagaagtgttttgagaccatcacaacaatctggtgctggagtttttccttcaccttcaacatagggaaggcacgat |
18323749 |
T |
|
| Q |
123 |
gctagccctgttaattgagctgtgcattcttgtttctctttggatgaatctgacattccaatcccaactatcattgatgctagtagtagaaaataagcca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18323748 |
gctagccctgttaattgagctgtgcattcttgtttctctttggatgaatctgacattccaatcccaactatcattgatgctagtagtagaaaataagcca |
18323649 |
T |
|
| Q |
223 |
tggtttttgtgttgtggtaaagcatttttgtgtgtgttgggatgagacagtgggaaagttaagttgttgaaagtaatgtgagattggaagtacttaaata |
322 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18323648 |
tggcttttgtgttgtggtaaagcatttttgtgtgtgttgggttgagaaagtgggaaagttaagttgttgaaagtaatgtgagattggaagtacttaaata |
18323549 |
T |
|
| Q |
323 |
aatatttgtggagaagtatatgttgttggtga |
354 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18323548 |
aatatttgtggagaagtatatgttgttggtga |
18323517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University