View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_high_21 (Length: 370)
Name: NF16929_high_21
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_high_21 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 130 - 349
Target Start/End: Original strand, 25000788 - 25001007
Alignment:
| Q |
130 |
gcgttatgagcacctgcatgaggagcttgatacggtcgagcggagcagtgaacgtcttagcagcagcgccggcgaatgctccggcggcgaagagagcggc |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25000788 |
gcgttatgagcacctgcatgaggagcttgatacggtcgagcggagcagtgaacgtcttagcagcagcgccggcgaatgctccggcggcgaagagagcggc |
25000887 |
T |
|
| Q |
230 |
atctctaggaacaaacgctaatgcagcgagtgggtgtttgagaagctgagacggcgtcggagcgaaatggttgtgaattttggcttctgcgacggagata |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25000888 |
atctctaggaacaaacgctaatgcagcgagtgggtgtttgagaagctgagacggcgtcggagcgaaatggttgtgaattttggcttctgcgacggagata |
25000987 |
T |
|
| Q |
330 |
gaggcgaatttggtgtctac |
349 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
25000988 |
gaggcgaatttggtgtctac |
25001007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 100
Target Start/End: Original strand, 25000680 - 25000758
Alignment:
| Q |
18 |
ttagttatagtatgtgattcagaagttacagttacaaatctcggttagttagttagttagttaccattagaatacttgcaagg |
100 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25000680 |
ttagttatagtttatgattcagaagttacagttacaaatttgg----gttagttagttagttaccattagaatacttgcaagg |
25000758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University