View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_high_42 (Length: 243)
Name: NF16929_high_42
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_high_42 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 7998940 - 7998698
Alignment:
| Q |
1 |
tttgcattctgatttgataattaaacttcgttgaatttttacaggggataaatgggtccatctatttcaaaaggggagggagccgatgacaattacaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7998940 |
tttgcattctgatttgataattaaactttgttgaatttttacaggggataaatgggtcgatctatttcaaaaggggagggagccgatgacaattacaatc |
7998841 |
T |
|
| Q |
101 |
aaatgtttcatgaacttatgcagagaatttatgcagatgtaagtcttgtattgtcgtgcaagaaactcacttttattaaacttgcacacgctcacaacct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7998840 |
aaatgtttcatgaacttatgcagagaatttatgcagatgtaagtcttgtattgtcgtgcaagaaactcacttttattaaacttgcacacgctcacaacct |
7998741 |
T |
|
| Q |
201 |
acaaagcacgaataatgacacgacacgaacactagtacatcga |
243 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
7998740 |
acaaagcatgaataatgacacgacacgaacactaatacatcga |
7998698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 198
Target Start/End: Original strand, 42550464 - 42550502
Alignment:
| Q |
160 |
aagaaactcacttttattaaacttgcacacgctcacaac |
198 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
42550464 |
aagaaactcacttttgttaaacttgcacactctcacaac |
42550502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University