View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_11 (Length: 465)
Name: NF16929_low_11
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 5e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 5e-94
Query Start/End: Original strand, 24 - 230
Target Start/End: Complemental strand, 50283588 - 50283382
Alignment:
| Q |
24 |
ataccttctagttctaccttcaataattgtgaacaactgacaactcggtaaggtaaaatctcctccatacatgttttatcaaatagtattagttcaatgg |
123 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
50283588 |
ataccttctagttctaccttcaacaattgtgaacaactgacaacttggtaaggtaaaatctcctccatagatgttttatcaaatagtattagttcaatag |
50283489 |
T |
 |
| Q |
124 |
taataaagtttgactccatggtccatggacacagctcaaatcccacgcgagacagttgtaaaatgttcgttaataacattgttattcatattaattttct |
223 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
50283488 |
caacaaagtttgactccatggtccatggacacagctcaaatcccacgcgagacagttgtaaaatggtcgttaataacattgttatttatattaattttct |
50283389 |
T |
 |
| Q |
224 |
ttcccaa |
230 |
Q |
| |
|
||||||| |
|
|
| T |
50283388 |
ttcccaa |
50283382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 408 - 444
Target Start/End: Complemental strand, 4279359 - 4279323
Alignment:
| Q |
408 |
ggaaatacttgttgccacgaagaagtattaaccacga |
444 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4279359 |
ggaaatacttattgccacgaagaagtattaaccacga |
4279323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University