View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_25 (Length: 360)
Name: NF16929_low_25
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 78 - 199
Target Start/End: Complemental strand, 33688864 - 33688743
Alignment:
| Q |
78 |
gttcataatatttatgcttagaaattatgttatgatccttgttagattaataagatgcgaaaacatgtagtagatgcagcaacaaaagcagagatgcctg |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33688864 |
gttcataatatttatgcttagaaattatgttatgatccttgttagattaataagatgcgaaaacatgtagtagatgcagcaacaaaagcagagatgcctg |
33688765 |
T |
 |
| Q |
178 |
caatatatacgatgttttaatc |
199 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
33688764 |
cagtatatacgatgttttaatc |
33688743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 16 - 63
Target Start/End: Complemental strand, 33688918 - 33688875
Alignment:
| Q |
16 |
tgaacatcccatgcactagttatgctttatatatctctttagctttga |
63 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
33688918 |
tgaacatcccatgcactagttatgctt----tatctctttagctttga |
33688875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University