View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_28 (Length: 345)
Name: NF16929_low_28
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_28 |
 |  |
|
| [»] scaffold0838 (1 HSPs) |
 |  |  |
|
| [»] scaffold0832 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 96; Significance: 5e-47; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 166 - 327
Target Start/End: Original strand, 40708023 - 40708184
Alignment:
| Q |
166 |
tgaaggactagtccaatttccaaaggaagaatataaggcgtggtattnnnnnnnnnnnnnnnnnnnnnntgaaaggcgttgtttactccaaacctggtcc |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40708023 |
tgaaggactagtccaatttccaaaggaagaatataaggcgtggtatttaaataaaaataaaaataaaaatgaaaggcgttgtttactccaaacctggtcc |
40708122 |
T |
 |
| Q |
266 |
acccattttgtgatgctgatgaaccttaacatcatctctcactttattattggggaagcatg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40708123 |
acccattttgtgatgctgatgaaccttaacatcatctctcactttattattggggaagcatg |
40708184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 37 - 138
Target Start/End: Original strand, 40707898 - 40707999
Alignment:
| Q |
37 |
tggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtcattgcataaacaaagagacactaagt |
136 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| |||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
40707898 |
tggtaagaagctacaactagtagcttttcaatatcacggtgaaaatgggttaaaatgtgctgcagcggtgggtcattgcataaacaaacagacactaagt |
40707997 |
T |
 |
| Q |
137 |
gt |
138 |
Q |
| |
|
|| |
|
|
| T |
40707998 |
gt |
40707999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 29 - 83
Target Start/End: Complemental strand, 45042141 - 45042087
Alignment:
| Q |
29 |
atcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatg |
83 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||||| |||||| ||||||||| |
|
|
| T |
45042141 |
atcacgtttgataagaagctacaactagtagcttttcattatcacggtgaaaatg |
45042087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 47; Significance: 9e-18; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 29 - 111
Target Start/End: Complemental strand, 4715519 - 4715437
Alignment:
| Q |
29 |
atcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtca |
111 |
Q |
| |
|
|||||||| | |||||||||| |||||||| ||||||| |||||| |||||||||||| ||||||| ||| |||||||||||| |
|
|
| T |
4715519 |
atcacgttcgataagaagctataactaataacttttcattatcacggtgaaaatgggtgaaaacgtactgtagcggtgggtca |
4715437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 13 - 111
Target Start/End: Original strand, 9476115 - 9476213
Alignment:
| Q |
13 |
aatatcacggtgaattatcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtca |
111 |
Q |
| |
|
||||||||||| || |||||||||| ||||||||||||| || |||||||||| |||||| |||||||||||| |||| |||| | || ||||||||| |
|
|
| T |
9476115 |
aatatcacggtcaacaatcacgtttgataagaagctacaattagtagcttttcattatcacggtgaaaatgggtgaaaatgtgcggcagtggtgggtca |
9476213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 29 - 111
Target Start/End: Complemental strand, 32048674 - 32048592
Alignment:
| Q |
29 |
atcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtca |
111 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||||||||| |||||| |||||||||| | ||| |||| | |||||||||||| |
|
|
| T |
32048674 |
atcacgtttgataagaagctgcaactagtagcttttcattatcacggtgaaaatggatgaaagcgtgtggcagcggtgggtca |
32048592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 29 - 96
Target Start/End: Original strand, 4392385 - 4392452
Alignment:
| Q |
29 |
atcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgc |
96 |
Q |
| |
|
|||||||||| |||||||||||||||| | | |||||| |||||| ||||| |||||| ||||||||| |
|
|
| T |
4392385 |
atcacgtttgataagaagctacaactagtggtttttcattatcactgtgaatatgggtgaaaacgtgc |
4392452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 29 - 111
Target Start/End: Original strand, 11141717 - 11141799
Alignment:
| Q |
29 |
atcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtca |
111 |
Q |
| |
|
|||||||||| ||||||| |||||||| ||| |||| | |||||| ||||||||| || |||| |||| | |||||||||||| |
|
|
| T |
11141717 |
atcacgtttgataagaagttacaactagtagttttttattatcaccgtgaaaatgagtgaaaaagtgcggcagcggtgggtca |
11141799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 29 - 107
Target Start/End: Original strand, 15605045 - 15605123
Alignment:
| Q |
29 |
atcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgg |
107 |
Q |
| |
|
|||||||| ||||||||| |||||| |||||||||||| |||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
15605045 |
atcacgttcggtaagaagttacaaccaatagcttttcattatcgtggtaaaaatgggttaaaacgtgctgcagcggtgg |
15605123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 124
Target Start/End: Complemental strand, 20011704 - 20011593
Alignment:
| Q |
13 |
aatatcacggtgaattatcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtcat |
112 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||||||||| |||||||| | ||||| ||| |||| | | ||||||||| | |||||| ||||| |
|
|
| T |
20011704 |
aatatcacggtgaatagtcacgttggataagaagctacaactagcagcttttctaaatcacggtggaaatagatcaaaacgtgcagtagcggtaggtcac |
20011605 |
T |
 |
| Q |
113 |
tgcataaacaaa |
124 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
20011604 |
tggataaacaaa |
20011593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 136
Target Start/End: Complemental strand, 33139620 - 33139497
Alignment:
| Q |
13 |
aatatcacggtgaattatcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtcat |
112 |
Q |
| |
|
||||||||||||||| ||||||| | ||||||||||| ||| ||| ||||| | ||||| |||||||| | ||| ||||||| | |||||| ||||| |
|
|
| T |
33139620 |
aatatcacggtgaatagtcacgttggataagaagctacggctagtagtttttctaaatcacggtgaaaatagattacaacgtgcggtagcggtaggtcac |
33139521 |
T |
 |
| Q |
113 |
tgcataaacaaagagacactaagt |
136 |
Q |
| |
|
|| ||||||||| || |||||||| |
|
|
| T |
33139520 |
tggataaacaaacaggcactaagt |
33139497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 13 - 124
Target Start/End: Complemental strand, 7925019 - 7924908
Alignment:
| Q |
13 |
aatatcacggtgaattatcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtcat |
112 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||||||||| |||||||| | ||||| ||| |||| | | ||||||||| | |||||| ||||| |
|
|
| T |
7925019 |
aatatcacggtgaatagtcacgttggataagaagctacaactagcagcttttctaaatcactgtggaaatagatcaaaacgtgcagtagcggtaggtcac |
7924920 |
T |
 |
| Q |
113 |
tgcataaacaaa |
124 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
7924919 |
tggataaacaaa |
7924908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0838 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0838
Description:
Target: scaffold0838; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 29 - 111
Target Start/End: Original strand, 3823 - 3905
Alignment:
| Q |
29 |
atcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtca |
111 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||| | ||||| |||||||||||| ||||| ||| | |||||||||||| |
|
|
| T |
3823 |
atcacgtttgataagaagctacaactagtagatttttattatcaaggtgaaaatgggtgaaaacatgcggcagcggtgggtca |
3905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0832 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: scaffold0832
Description:
Target: scaffold0832; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 29 - 111
Target Start/End: Original strand, 3854 - 3936
Alignment:
| Q |
29 |
atcacgtttggtaagaagctacaactaatagcttttcaatatcacagtgaaaatgggttaaaacgtgctggagcggtgggtca |
111 |
Q |
| |
|
|||||||||| |||||||||||||||| ||| |||| | ||||| |||||||||||| ||||| ||| | |||||||||||| |
|
|
| T |
3854 |
atcacgtttgataagaagctacaactagtagatttttattatcaaggtgaaaatgggtgaaaacatgcggcagcggtgggtca |
3936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University