View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_30 (Length: 334)
Name: NF16929_low_30
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_30 |
 |  |
|
| [»] scaffold1152 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 12 - 317
Target Start/End: Complemental strand, 34199952 - 34199644
Alignment:
| Q |
12 |
atgaaacatgcaagcaaaaatgaaaatagtagaatggaatagaatacctagaagaacgtctttcagattcgttggatggtaacgagtttttcttgacgga |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34199952 |
atgaaacatgcaagcaaaaatgaaaatagtagaatggaatagaatacctagaagaacgtctttcagattcgttggatggtaacgagtttttcttgacgga |
34199853 |
T |
 |
| Q |
112 |
ggggcgcggttttggtgttttcttgaggttacaagaaagctttaacaaaccaagcttatgcattctctcagcgttctctttcatcctttgttccctaatc |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34199852 |
ggggcgcggttttggtgttttcttgaggttaccagaaagctttaacaaaccaagcttatgcattctctcagcgttctcttccatcctttgttccctaatc |
34199753 |
T |
 |
| Q |
212 |
cgttcgtaatgcgatgatgaacctgaaacgacaacaccttcgtcaccgttagttttctccgttttggtttcggtgatg---gcgccgccatcttcaccgt |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
34199752 |
cgttcgtaatgcgatgatgaacctgaaacgacaacaccttcgtcaccgttagttttctccgttttggtttcggtggtggctgcgccgccatcttcaccgt |
34199653 |
T |
 |
| Q |
309 |
cagaagaag |
317 |
Q |
| |
|
||||||||| |
|
|
| T |
34199652 |
cagaagaag |
34199644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1152 (Bit Score: 121; Significance: 6e-62; HSPs: 1)
Name: scaffold1152
Description:
Target: scaffold1152; HSP #1
Raw Score: 121; E-Value: 6e-62
Query Start/End: Original strand, 123 - 318
Target Start/End: Complemental strand, 2027 - 1829
Alignment:
| Q |
123 |
ttggtgttttcttgaggttacaagaaagctttaacaaaccaagcttatgcattctctcagcgttctctttcatcctttgttccctaatccgttcgtaatg |
222 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2027 |
ttggtgttttcttgaggttaccagaaagctttaacaatccaagcttatgcattctctcagcgttctctttcatcctttgttccctaatctattcgtaata |
1928 |
T |
 |
| Q |
223 |
cgatgatgaacctgaaacgacaacaccttcgtcaccgttagttttctccgttttggtttcggtgatggc---gccgccatcttcaccgtcagaagaagt |
318 |
Q |
| |
|
||||||||||| |||| |||||||||| |||||||| ||||||| ||||||||||||||||| |||| || ||||||||||| || ||||||||| |
|
|
| T |
1927 |
tgatgatgaacccaaaactacaacacctttgtcaccgtcagttttcgccgttttggtttcggtggtggctgggctgccatcttcacggttagaagaagt |
1829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 69; Significance: 6e-31; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 202 - 317
Target Start/End: Complemental strand, 40812248 - 40812130
Alignment:
| Q |
202 |
ttccctaatccgttcgtaatgcgatgatgaacctgaaacgacaacaccttcgtcaccgttagttttctccgttttggtttc---ggtgatggcgccgcca |
298 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||| |||||| |||||||||||||||||| ||||||| ||||||||||||| |||| | |||| |||| |
|
|
| T |
40812248 |
ttccctaatctgttcgtaatgtgatgatgaaccagaaacggcaacaccttcgtcaccgtcagttttcgccgttttggtttcgttggtggttgcgctgcca |
40812149 |
T |
 |
| Q |
299 |
tcttcaccgtcagaagaag |
317 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
40812148 |
tcttcaccgtcagaagaag |
40812130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University