View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_34 (Length: 284)
Name: NF16929_low_34
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 10 - 266
Target Start/End: Complemental strand, 46716407 - 46716151
Alignment:
| Q |
10 |
attattcttgtcacttcagaaaaaggttatcatattgtatcgggaaaaatccctgctgaccccgtttcaacaactctcgatctcgatcaattccgctatg |
109 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46716407 |
attattcttgtcacttcagaaaaagattatcatattgtatcgggaaaaatccctgctgaccctgtttcaacaactctcgatctcgatcaattccgctatg |
46716308 |
T |
 |
| Q |
110 |
gcgccgacgtcgtttgatcctgctaacatgtaacgttttcttattcatacttcaacaattcaattttcacattcatctccttaatcaattcttcatgtct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46716307 |
gcgccgacgtcgtttgatcctgctaacatgtaacgttttctcattcatacttcaacaattcaattttcacattcatctccttaatcaattcttcatgtct |
46716208 |
T |
 |
| Q |
210 |
tccctttaactgctatgctacagagaacccgttgcaagaaggaagaacaatggtcct |
266 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46716207 |
tccctttaactgctatgctacagagaacccgttgcaagaaggaagaacaatggtcct |
46716151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University