View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_39 (Length: 259)
Name: NF16929_low_39
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_39 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 66; Significance: 3e-29; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 85
Target Start/End: Complemental strand, 35601638 - 35601553
Alignment:
| Q |
1 |
ccattagcttgcttgaatatatcaaagtggtcatatggaacggaatgcatgctg-tttgttcgaaaccgattgtaaatttatagct |
85 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||| ||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
35601638 |
ccattagcttgcttgaatatatcaaagtggtcatatggaacagaatacatgctgttttgttcgaaaacgattgtaaatttatagct |
35601553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 35639376 - 35639461
Alignment:
| Q |
1 |
ccattagcttgcttgaatatatcaaagtggtcatatggaacggaatgcatgctg-tttgttcgaaaccgattgtaaatttatagct |
85 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| |||| ||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
35639376 |
ccattagcttgcttgaatatatcaaagtgatcatatggaacagaatacatgctgttttgttcgaaaacgattgtaaatttatagct |
35639461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 190 - 246
Target Start/End: Original strand, 35639558 - 35639614
Alignment:
| Q |
190 |
aaataaaataactcattgtattgctaaactctctttatgtgatcatagcccccatat |
246 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
35639558 |
aaataaaataactcattgtattgctaaattctctttatgtgatcatagcccccatat |
35639614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 68 - 101
Target Start/End: Complemental strand, 35601531 - 35601498
Alignment:
| Q |
68 |
gattgtaaatttatagctaatactcttgccttat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35601531 |
gattgtaaatttatagctaatactcttgccttat |
35601498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 68 - 101
Target Start/End: Original strand, 35639481 - 35639514
Alignment:
| Q |
68 |
gattgtaaatttatagctaatactcttgccttat |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35639481 |
gattgtaaatttatagctaatactcttgccttat |
35639514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University