View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_41 (Length: 249)
Name: NF16929_low_41
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_41 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 28735381 - 28735588
Alignment:
| Q |
1 |
cattttaactttgtctttagattttaaagatattccacgtccaggaatttacgcatcgattaagttgaagtcgggctaaatctactgcaaatacttttaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| || |||||||||| |||||||||||||||||||| || |||||||||||||||||||||| | |
|
|
| T |
28735381 |
cattttaactttgtctttagattttaatgatattccgcggccaggaatttttgcatcgattaagttgaagtcaggataaatctactgcaaatacttttca |
28735480 |
T |
|
| Q |
101 |
tatgatgcaattttttcttatgttggagattgtattttgcaggagaaagcacacagtgatttctacttatttgataggtaaagatgcatacttaatattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| || |||||||||| |||||||| ||||||||||| |
|
|
| T |
28735481 |
tatgatgcaattttttcttatgttggagattgtattttgcaggagaaagcactcaaagatttctgctaatttgatagggaaagatgcctacttaatattt |
28735580 |
T |
|
| Q |
201 |
ccatggtt |
208 |
Q |
| |
|
||| |||| |
|
|
| T |
28735581 |
ccaaggtt |
28735588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 175 - 237
Target Start/End: Original strand, 28730842 - 28730904
Alignment:
| Q |
175 |
taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730842 |
taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc |
28730904 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University