View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_43 (Length: 248)
Name: NF16929_low_43
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 135 - 238
Target Start/End: Complemental strand, 18742104 - 18742001
Alignment:
| Q |
135 |
agaagaacatctaaaaatttggcaaattgaaacatttttggaggaaagcttgaaaaactagggtagaaagaatagccaaaaataagttgttacattttcc |
234 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
18742104 |
agaaggacatctaaaaatttggcaaattgaaacgtttttggaggaaagcttgaaaaactagggtagaaagaagagccaaaaagaagttgttacattttcc |
18742005 |
T |
 |
| Q |
235 |
tatg |
238 |
Q |
| |
|
|||| |
|
|
| T |
18742004 |
tatg |
18742001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University