View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_48 (Length: 238)
Name: NF16929_low_48
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_48 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 41989188 - 41989007
Alignment:
| Q |
19 |
aatcaaaaccagcatgacaaattcattcaccacgacacctcttccctctcttcttctctctttagaaacatttttcttcccttagcatttaacacactga |
118 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
41989188 |
aatcgaaaccagcatgacaaattcattcaccacaacacctcttccctatcttcttctctctttagaaacctttttcttcccttagcatttaacacactga |
41989089 |
T |
 |
| Q |
119 |
tttttaagaaaaacaacgacccatcacctaagcttttggattgagaaggtggtggtggtggtagtgacaacggtggttagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41989088 |
tttttaagaaaaacaacgacccatcacctaagcttttggattgagaaggtggtggtggtggtagtgacaacggtggttagaa |
41989007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 200
Target Start/End: Complemental strand, 35758701 - 35758517
Alignment:
| Q |
19 |
aatcaaaaccagcatgacaaattcattcaccacgacacctcttccctctcttcttctctctttagaaacatttttcttcccttagcatttaacacactga |
118 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
35758701 |
aatcgaaaccagcatgacaaattcattcaccacggcgcctcttccctcttttcttctctctttagaaacctttttcttccctcagcatttaacacactga |
35758602 |
T |
 |
| Q |
119 |
tttttaagaaaaacaacgacccatcacctaagcttttggattgagaaggtggtggtgg---tggtagtgacaacggtggttagaa |
200 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
35758601 |
tttttaagaaaaacatcgacccatcacctaagcttttggatggagaaggtggtggtggtggtggtagtgacaatggtggtgagaa |
35758517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University