View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_55 (Length: 236)
Name: NF16929_low_55
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 6 - 227
Target Start/End: Complemental strand, 6855057 - 6854836
Alignment:
| Q |
6 |
tctgtaatattgtgtgcagttgaaatggaatggttctagcaatggtgctcctatgacaaattcagcatttttcggaacatactttaagaaagcaagttct |
105 |
Q |
| |
|
||||||| | ||| |||||||||||| |||||| ||||||| ||| | |||||||||||||||||||||||| |||||| | |||||||||| || ||| |
|
|
| T |
6855057 |
tctgtaacactgtatgcagttgaaattgaatggctctagcagtggagttcctatgacaaattcagcattttttggaacaagccttaagaaagcgagatct |
6854958 |
T |
 |
| Q |
106 |
gcgatttccagccagaagagtttgtctggtagtttcaaggtttcggcaaaaattgactataatgaggagaagcagacctcaaaggacagatgggctggac |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6854957 |
gcgatttccagccagaagagtttgtctggtaattttaaggtttcggcaaaaattgactataatgaggagaagcagacctcaaaggacagatgggctgggc |
6854858 |
T |
 |
| Q |
206 |
ttgcctatgatacctctgatga |
227 |
Q |
| |
|
|||| ||||| ||||| ||||| |
|
|
| T |
6854857 |
ttgcttatgacacctcggatga |
6854836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University