View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16929_low_58 (Length: 223)
Name: NF16929_low_58
Description: NF16929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16929_low_58 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 5296889 - 5297094
Alignment:
| Q |
1 |
gtagtgaaaaaggaaaagtgaaggagtcccatctgcttattgatatatagcgaagagaatcacaactacggaaattccaagaattccatcctggatacgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5296889 |
gtagtgaaaaaggaaaagtgaaggagcgccatctgcttattgatatatggcgaagagaatcacaactacggaaattccaagaattccatcctggatacgt |
5296988 |
T |
 |
| Q |
101 |
accattgaagtcgtcaacaaacaaattttcaagaacggtattgttgagtagaattagctccaaggaagactcgatgatccgagatccacaaaggatgaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5296989 |
accattgaagtcgtcaacaaacaaattttcaagaacggtattgttgagtagaattagctccaaggaagactcgatgatcccagatccacaaaggatgaca |
5297088 |
T |
 |
| Q |
201 |
tttttc |
206 |
Q |
| |
|
|||||| |
|
|
| T |
5297089 |
tttttc |
5297094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University