View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1692_high_18 (Length: 278)
Name: NF1692_high_18
Description: NF1692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1692_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 1 - 269
Target Start/End: Complemental strand, 42511442 - 42511172
Alignment:
| Q |
1 |
aagatttgacctagttcagcaatactatgtttaaaaaattcagattgtcctaattaaattcaaattttatactgcgttcattcagtgttggtgttgagct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42511442 |
aagatttgacctagttcagcaatactatgtttaaaaaattcagattgtcctaattaaattcaaattttatactgcgttcattcagtgttggtgttgagct |
42511343 |
T |
 |
| Q |
101 |
ctttgatctgttgtgttgccgtgcaatttcggttcgtttgttattggtttaagcatttcgctttgatctaattttaaaaattttgagtcgggttgttttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42511342 |
ctttgatctgttgtgttgccgtgcaatttcggtttgtttgttattggtttacgcatttcgctttgatctaattttgaaaattttgagtcgggttgttttc |
42511243 |
T |
 |
| Q |
201 |
tagatttaagattgt--tgtattctcttaactttaaagggtttgttggtgactaacgtgttgggttcatct |
269 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42511242 |
tagatttaagattgttgtgtattctcttaatcttaaagggtttgttggtgactaacgtgttgggctcatct |
42511172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University