View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1692_high_23 (Length: 242)
Name: NF1692_high_23
Description: NF1692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1692_high_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 10 - 226
Target Start/End: Complemental strand, 4440769 - 4440553
Alignment:
| Q |
10 |
acatcatcatctaatcactagctgattgcacaccgccagtagaatcacctgatatcgttgttacaataccgtcactcaatttgtctatgttagtaggtgc |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4440769 |
acatcctcatctaatcactagctgattgcacaccgccagtagaaccacctgacatcgtttttacaataccgtcactcaatttgtctatgttagtaggtgc |
4440670 |
T |
|
| Q |
110 |
acttataacaggcctgaatttgttgaatttaattagtctaaagaattagataggatgttaattgttcctggcacaatagcattggcaacaagagaagcaa |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
4440669 |
acttataacaggcctgaatttgttgaatttaatttgtctaaagaattagataggatgttaattattcctggcacaatagcattggcaacaagagaagcaa |
4440570 |
T |
|
| Q |
210 |
tagtcctacaaagttcc |
226 |
Q |
| |
|
|| |||||||||||||| |
|
|
| T |
4440569 |
taatcctacaaagttcc |
4440553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University