View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1692_high_6 (Length: 449)
Name: NF1692_high_6
Description: NF1692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1692_high_6 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 265; Significance: 1e-148; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 142 - 434
Target Start/End: Original strand, 19596963 - 19597255
Alignment:
| Q |
142 |
catgaactcccttaccacgtaagaaagatagaaaacacaagaggttgcggcaaaggctatgaagatttcaactggatcaatgatctgcatattatgttgt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
19596963 |
catgaactcccttaccacgtaagaaagatagaaaacacaagaggttgcggcaaagactatgaagatttcaattggatcaatgatctgcatattatcttgt |
19597062 |
T |
|
| Q |
242 |
tcattagattgtgatgctcttcgtaatggtgatgatggtggtgatactgttggtgatggtgttgatggtcgtcctagtgggtatcttctagggatcactg |
341 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19597063 |
tcattagattgcgatgctcttcgtaatggtgatgatggtggtgatactgttggtgatggtgttgatggtcgtcctgatgggtatcttctagggatcactg |
19597162 |
T |
|
| Q |
342 |
aatgatatattggtggtgggttcactgaacgaggccatggaggacgaatgtgactcgatgaaaaattagaatggtatggtgatggtgatgatg |
434 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
19597163 |
aatgatatattggtggtgggttcactgaacgaggccatggaggacgaatgtgactcgatgaaaaattagaatggtatggtaatggtgatgatg |
19597255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 84; E-Value: 9e-40
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 19596824 - 19596915
Alignment:
| Q |
1 |
tcaatcttctttgaattgtctgataatgtcaaaaatctgaaacaacaataatataattaattaacaactcatagaacttcaccgaatattac |
92 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19596824 |
tcaatcttctttgaattgtctgataatgtgaaaaatctgaaacaacaataatataattaattaacaactgatagaacttcaccgaatattac |
19596915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 264 - 310
Target Start/End: Original strand, 19597241 - 19597287
Alignment:
| Q |
264 |
gtaatggtgatgatggtggtgatactgttggtgatggtgttgatggt |
310 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19597241 |
gtaatggtgatgatggtggtgatactgttggtgatggtgttgatggt |
19597287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University