View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1692_low_27 (Length: 238)
Name: NF1692_low_27
Description: NF1692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1692_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 16 - 221
Target Start/End: Original strand, 48221671 - 48221876
Alignment:
| Q |
16 |
atgaaaccactatgtctgtgtatggtgctgatatcatgcttgggaccggacacgatcaataatagaaccgtgaactatgccatctagcctagcctagcca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48221671 |
atgaaaccactatgtctgtgtatggtgctgatatcatgcttgggaccggacacgatcaataatagaaccgtgaactatgccatctagcctagcctagcca |
48221770 |
T |
 |
| Q |
116 |
agaaagtaagaacaatatgattggatattttctctgtcttcaacaaattacacctagcattggtgttcctattttgcttctattgaatagaaagaaccac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48221771 |
agaaagtaagaacaatatgattggatattttctctgtcttcaacaaattacacctagcattggtgttcctattttgcctctattgaatagaaagaaccac |
48221870 |
T |
 |
| Q |
216 |
catatt |
221 |
Q |
| |
|
|||||| |
|
|
| T |
48221871 |
catatt |
48221876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University