View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1692_low_32 (Length: 207)
Name: NF1692_low_32
Description: NF1692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1692_low_32 |
 | |
|
| [»] scaffold0848 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 41 - 192
Target Start/End: Original strand, 47392068 - 47392219
Alignment:
| Q |
41 |
gattcaacaacagcagctccccggcacaggaatctctatagtactagctttcccaacatgaagatcactcattggcaaacaccacattgcatcactttac |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47392068 |
gattcaacaacagcagctccccggcacaggaatctctatagtactagctttcccaacatgaagatcactcattggcaaacaccacattgcatcactttac |
47392167 |
T |
|
| Q |
141 |
tcaaattcggcctaacctgttgcaacaaacacaccatcccagccgaagaata |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47392168 |
tcaaattcggcctaacctgttgcaacaaacacaccatcccagccaaagaata |
47392219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 57 - 192
Target Start/End: Complemental strand, 40624021 - 40623885
Alignment:
| Q |
57 |
ctccccggcacaggaatctctatagtactagctttcccaacatgaagatcactcattggcaaacaccacattgcatca-ctttactcaaattcggcctaa |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40624021 |
ctccccggcacaggaatctctatagtactagctttcccaacatgaagatcactcattagcaaacaccacattgcatcacctttactcaaattcggcctaa |
40623922 |
T |
|
| Q |
156 |
cctgttgcaacaaacacaccatcccagccgaagaata |
192 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40623921 |
cctgttgcaacaaacacaccatcccagccaaagaata |
40623885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0848 (Bit Score: 124; Significance: 6e-64; HSPs: 1)
Name: scaffold0848
Description:
Target: scaffold0848; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 65 - 192
Target Start/End: Complemental strand, 3791 - 3664
Alignment:
| Q |
65 |
cacaggaatctctatagtactagctttcccaacatgaagatcactcattggcaaacaccacattgcatcactttactcaaattcggcctaacctgttgca |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3791 |
cacaggaatctctatagtactagctttcccaacatgaagatcactcattggcaaacaccacattgcatcactttactcaaattcggcctaacctgttgca |
3692 |
T |
|
| Q |
165 |
acaaacacaccatcccagccgaagaata |
192 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
3691 |
acaaacacaccatcccagccaaagaata |
3664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University