View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1693-Insertion-5 (Length: 108)
Name: NF1693-Insertion-5
Description: NF1693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1693-Insertion-5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 2e-40; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 2e-40
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 26827953 - 26827851
Alignment:
| Q |
8 |
cttagtgtgatctatcattgacatagtgtaaatacttgcaaggatgcaacttcacattgagtgag--aacaataaagttttctgagattttatttatcat |
105 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
26827953 |
cttagtgtgatttatcattgaaatagtgtaaatacttgcaaggatgcaacttcacattgagtgagaaaacaataaagttttctgagattttatttatcat |
26827854 |
T |
 |
| Q |
106 |
tca |
108 |
Q |
| |
|
||| |
|
|
| T |
26827853 |
tca |
26827851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University