View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_high_12 (Length: 305)
Name: NF16930_high_12
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_high_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 2 - 292
Target Start/End: Complemental strand, 47828460 - 47828161
Alignment:
| Q |
2 |
tgaagggtgtccggtgtccaacatgtgtcagtgtccgagaacaacaaacaccgacaaat---------aatgaattatttctatcagagttgtgtttggt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
47828460 |
tgaagggtgtccggtgtccaacatgtgtcagtgtccgagaacaacaaacaccgacaaatgtggctgtaaatgaattatttctatcagagttgtgtttggt |
47828361 |
T |
|
| Q |
93 |
tcgtttttgtgtctttacttgataggtcaacattgtaaagaacataccagccaaaaatctagcattcttgtgatcactttctagcttttcaacattttca |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47828360 |
tcgtttttgtgtctttacttgataggtcaacattgtaaagaacataccagccaaaaatctagcattcttgtgatcactttctagcttttcaacattttca |
47828261 |
T |
|
| Q |
193 |
tgtaatgcaacaagtgcagctgcacaaaggatgccaacctgtctcattccaccacctaaggtctttctaagccttctagcctaaaatagcagatatacat |
292 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47828260 |
tgtaatgcaacaagtgcagctgcacaaaggatgccaacctgtctcattccaccacctaaggtctttctaagccttctagcctaaaatagcagatatacat |
47828161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 74; Significance: 6e-34; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 137 - 254
Target Start/End: Original strand, 35629000 - 35629117
Alignment:
| Q |
137 |
taccagccaaaaatctagcattcttgtgatcactttctagcttttcaacattttcatgtaatgcaacaagtgcagctgcacaaaggatgccaacctgtct |
236 |
Q |
| |
|
|||||||||||| ||||| ||||||||||||||||| |||||| |||||||||| | ||| |||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
35629000 |
taccagccaaaagtctagttttcttgtgatcactttccagctttccaacattttcctttaaggcaacaagtgcagcagcacaaaggatgccaatctgtct |
35629099 |
T |
|
| Q |
237 |
cattccaccacctaaggt |
254 |
Q |
| |
|
|||||||||||| ||||| |
|
|
| T |
35629100 |
cattccaccacccaaggt |
35629117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University