View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_high_19 (Length: 274)
Name: NF16930_high_19
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 170; Significance: 3e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 71 - 259
Target Start/End: Original strand, 12888407 - 12888602
Alignment:
| Q |
71 |
ggggtagatagagatatttattttccatgttagctgtctatttgtcgaaaagaaggtgaaggttaacccttgcctccctccatgaaactctcaaatagtc |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12888407 |
ggggtagatagagatatttattttccatgttagctgtctatttgtcgaaaagaaggtgaaggttaacccttgcctccctccatgaaactctcaaatagtc |
12888506 |
T |
 |
| Q |
171 |
tcttaaagaaacaataagaaaattgacataatgcatactaagaaactttctatg-------aggccactgacttggggtatcttggaagctgcatt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12888507 |
tcttaaagaaacaataagaaaattgacataatgcatactaagaaactttctatgaggccacaggccactgacttggggtatcttggaagctgcatt |
12888602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University