View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_high_33 (Length: 212)
Name: NF16930_high_33
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_high_33 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 19 - 194
Target Start/End: Original strand, 31158005 - 31158180
Alignment:
| Q |
19 |
ttataacacctttgattaatttgaagtatggctcccaaatctgacttgcatagaaatgttgcagattataaacctagcgtttggggagattatttccttc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31158005 |
ttataacacctttgattaatttgaagtatggctcccaaatctgacttgcatagaaatgttgcagattataaacctagcgtttggggagattatttccttc |
31158104 |
T |
 |
| Q |
119 |
gatatgcttctgaatctatggtacgtaaacatttctagattattatatggtacacaagtatatgctatctccgttc |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31158105 |
gatatgcttctgaatctatggtacgtaaacatttctagattattatatggtacacaagtatatgctacctccgttc |
31158180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 53 - 142
Target Start/End: Original strand, 31198092 - 31198181
Alignment:
| Q |
53 |
ccaaatctgacttgcatagaaatgttgcagattataaacctagcgtttggggagattatttccttcgatatgcttctgaatctatggtac |
142 |
Q |
| |
|
|||| |||||| |||||||||||||||| |||| | ||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
31198092 |
ccaattctgacatgcatagaaatgttgctgattttcaacctagcgtttggggagattatttccttcgctatgcttcagaatctatggtac |
31198181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 55 - 142
Target Start/End: Complemental strand, 41352780 - 41352693
Alignment:
| Q |
55 |
aaatctgacttgcatagaaatgttgcagattataaacctagcgtttggggagattatttccttcgatatgcttctgaatctatggtac |
142 |
Q |
| |
|
||||||||| | |||||||||||||| |||| | | |||| ||||||||||||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
41352780 |
aaatctgaccttcatagaaatgttgccgattttcaccctaacgtttggggagattatttccttcaatatgcttcagaatctatggtac |
41352693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 53 - 141
Target Start/End: Original strand, 25791651 - 25791739
Alignment:
| Q |
53 |
ccaaatctgacttgcatagaaatgttgcagattataaacctagcgtttggggagattatttccttcgatatgcttctgaatctatggta |
141 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
25791651 |
ccaaatctgacttgcgtagaaatgttgcagattatcaacctagcgtttggggagattatttcattcaatatgcttcagaatctatggta |
25791739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 53 - 141
Target Start/End: Original strand, 2325656 - 2325744
Alignment:
| Q |
53 |
ccaaatctgacttgcatagaaatgttgcagattataaacctagcgtttggggagattatttccttcgatatgcttctgaatctatggta |
141 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||| | ||| |||||||||||||||||||| ||| ||||| ||| |||||| ||||| |
|
|
| T |
2325656 |
ccaaatctgacttgcaaagaaatcttgcagatttccacccttgcgtttggggagattatttcattcaatatgattcagaatctgtggta |
2325744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 71 - 142
Target Start/End: Original strand, 17178795 - 17178866
Alignment:
| Q |
71 |
gaaatgttgcagattataaacctagcgtttggggagattatttccttcgatatgcttctgaatctatggtac |
142 |
Q |
| |
|
|||||||||| |||||| | |||||| ||||| ||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
17178795 |
gaaatgttgctgattatcaccctagcatttggaaggattatttccttcaatatgcttcagaatctatggtac |
17178866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University