View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_high_6 (Length: 346)
Name: NF16930_high_6
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 9 - 274
Target Start/End: Complemental strand, 47536397 - 47536132
Alignment:
| Q |
9 |
gaagaaaatgaagaatcagctaaagtatacacaaccagtgcatcttccttcactgcttgctttattatctccaataacctctctacatcatcaatctagt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47536397 |
gaagaaaatgaagaatcagctaaagtatacacaaccagtgcatcttccttcactgcttgctttattatctccaataacctctctacatcatcaatctagt |
47536298 |
T |
 |
| Q |
109 |
caacaacaacaaaatataaacaatttgtcnnnnnnnnnnnnnttgcgatgattaaaattagtgttttgaatagtataatatatgctattatcgagtgaat |
208 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
47536297 |
caacaacaacaaaatataaacaatttgtcaaaaaaacaaaaattgcgatgattaaaattagtgttttgaatagtataatatatgctattttcgagtgaat |
47536198 |
T |
 |
| Q |
209 |
aagaatattgttccacggaattgtaattattggtaaaaatagtccctaattttttcggattagcaa |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47536197 |
aagaatattgttccacggaattgtaattattggtaaaaatagtccctaattttttcggattagcaa |
47536132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 295 - 328
Target Start/End: Complemental strand, 47536095 - 47536062
Alignment:
| Q |
295 |
ctcagattgtaaaatgtcggtcaaaatagtctct |
328 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
47536095 |
ctcagattgtaaaatgtcggtcaaaatagtctct |
47536062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University