View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_low_20 (Length: 279)
Name: NF16930_low_20
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 20 - 158
Target Start/End: Complemental strand, 18696810 - 18696673
Alignment:
| Q |
20 |
atctgcaaaatctttacatgaataaataccatacataatccataccatgaatacaaaactattaaaaactatcaatgtgcatactataaatgattattat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| | | |||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
18696810 |
atctgcaaaatctttacatgaataaataccatatataattctcatcatgaatacaaaactattaaaat-tattaatgtgcatactataaatgattattat |
18696712 |
T |
 |
| Q |
120 |
agggaaatttttagttcttaatataattgccagtgctag |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18696711 |
agggaaatttttagttcttaatataattgctagtgctag |
18696673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University