View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_low_26 (Length: 253)
Name: NF16930_low_26
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 39 - 241
Target Start/End: Original strand, 47324794 - 47324991
Alignment:
| Q |
39 |
ttgatttttgaacaacacatatggtcctgtaacctgttattgattaatatattttgccgttataaaagaaaaatgaaattatgaatagcagtgtattata |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47324794 |
ttgatttttgaacaacacatatggtcctgtaacctgttattgattaatatattttgccgttataaaagaaaaatgaaattatgaatagcagtgtat---- |
47324889 |
T |
 |
| Q |
139 |
tagctatctcattttaaatttgaatggcttttgcgcttttttctttgaactttagagtgtttcttaagcaagggtgaatcacgtacacttttactatgat |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47324890 |
-agctatctcattttaaatttgaatggcttttgcgcttttttctttgaactttagagtgtttcttaagcaagggtgaatcacgtacacttttactatgat |
47324988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University