View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16930_low_26 (Length: 253)

Name: NF16930_low_26
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16930_low_26
NF16930_low_26
[»] chr3 (1 HSPs)
chr3 (39-241)||(47324794-47324991)


Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 39 - 241
Target Start/End: Original strand, 47324794 - 47324991
Alignment:
39 ttgatttttgaacaacacatatggtcctgtaacctgttattgattaatatattttgccgttataaaagaaaaatgaaattatgaatagcagtgtattata 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
47324794 ttgatttttgaacaacacatatggtcctgtaacctgttattgattaatatattttgccgttataaaagaaaaatgaaattatgaatagcagtgtat---- 47324889  T
139 tagctatctcattttaaatttgaatggcttttgcgcttttttctttgaactttagagtgtttcttaagcaagggtgaatcacgtacacttttactatgat 238  Q
     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47324890 -agctatctcattttaaatttgaatggcttttgcgcttttttctttgaactttagagtgtttcttaagcaagggtgaatcacgtacacttttactatgat 47324988  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University