View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_low_31 (Length: 246)
Name: NF16930_low_31
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 15 - 227
Target Start/End: Original strand, 51755663 - 51755875
Alignment:
| Q |
15 |
gagatgaacatgtcagaaaattctccacttgacactctagctttcaactacttgagcttcgatttcttcaaccatttatggacatggctcgccgtaatct |
114 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51755663 |
gagatgaacatgttagaaaattctccacttgacactctagctttcaactacttgagcttcgatttcttcaaccatttatggacatggctcgccgtcatct |
51755762 |
T |
|
| Q |
115 |
tctggaggatcccaacccctaaacctgaattgttacctccttcccacgacacttcctccgataaacctcacctaggtctggaagtgttggaacctcgtca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51755763 |
tctggaggatcccaacccctaaacctgaattgttacctccttcccacgacacttcctccgataaacctcacctaggtctggaagtgttggaacctcgtca |
51755862 |
T |
|
| Q |
215 |
tgatgatgcttgt |
227 |
Q |
| |
|
|||| |||||||| |
|
|
| T |
51755863 |
tgattatgcttgt |
51755875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University