View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_low_33 (Length: 240)
Name: NF16930_low_33
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 14050526 - 14050318
Alignment:
| Q |
14 |
ttatacttaaatcagaaagaggaaaacacttcgaaaagatccatacgttaggttgtagatcaacaactcaacataaataaggctgcaaaaccaagaccaa |
113 |
Q |
| |
|
||||||||| |||||||| |||||||||||||| |||||||||||| |||| || ||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
14050526 |
ttatacttacatcagaaaaaggaaaacacttcggaaagatccatacattagactgcagatcaacaactcaacataaataaggcagcaaaaccaagaccaa |
14050427 |
T |
 |
| Q |
114 |
aatacatcccccatcaaatttaaaacacaaaccttttccgagtatacaagtacaccaatgaacttttttgaccaatccttagtattttccaaggaaataa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
14050426 |
aatacatcccccatcaaatttaaaacacaaaccttttccgagtataca---acaccaatgaacttttttgaccaatcctcagtattttccaaggaaataa |
14050330 |
T |
 |
| Q |
214 |
atttgcagttta |
225 |
Q |
| |
|
|||||||||||| |
|
|
| T |
14050329 |
atttgcagttta |
14050318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University