View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_low_39 (Length: 217)
Name: NF16930_low_39
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_low_39 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 14 - 198
Target Start/End: Complemental strand, 40816489 - 40816305
Alignment:
| Q |
14 |
cataggggagaagacaactgtgctgctaagctgactgatcagtctgagattattatatatacgtcaaaaaacagtagtagtaccacagcctgtatgtaag |
113 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40816489 |
cataagggagaagacaactgtgttgctaagctgactgatcagtctgagattattatatatacgtcaaaaaacagtagtagtaccacagccagtatgtaag |
40816390 |
T |
|
| Q |
114 |
tttcagacaatatcaaaatagactcatgttacatggttcgattaaatttctaaatgtacaatacacacaaaataaattcaatata |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40816389 |
tttcagacaatatcaaaatagactcatgttacatggttcgattaaatttctaaatgtacaatacactcaaaataaattcaatata |
40816305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University