View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16930_low_42 (Length: 206)
Name: NF16930_low_42
Description: NF16930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16930_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 13 - 198
Target Start/End: Complemental strand, 7236041 - 7235855
Alignment:
| Q |
13 |
aatataatgaagcgtnnnnnnntgtaacaaaacaatgaaacaaattataagcttcgaagcaacataaataatatatttcaaa-ttaattattacatatat |
111 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
7236041 |
aatataatgaagcgtaaaaaaatgtaacaaaataatgaaacaaattataagcttcgaagcaacataaataatatattttaaaattaattattacatatat |
7235942 |
T |
 |
| Q |
112 |
ttgatacgtagcgggttggaaagaatactaattatccctcagttcgaggtcatggcaatgccatcaaattaagagagaagaagaaaa |
198 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7235941 |
ttgatatgtagcgggttggaaagaatacgaattatccctcagttcgaggtcatggcaatgccttcaaattaagagagaagaagaaaa |
7235855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University