View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16931_high_28 (Length: 372)
Name: NF16931_high_28
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16931_high_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 153 - 356
Target Start/End: Original strand, 30385224 - 30385431
Alignment:
| Q |
153 |
atttaatacctgaaaccaccctatatatacacactctcattccctctctatacatcttcacttcacttcatatattattttcttccacctaattaattat |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30385224 |
atttaatacctgaaaccaccctatatatacacactctcattccctctctatacatcttcacttcacttcatatattattttcttccacctaattaattat |
30385323 |
T |
 |
| Q |
253 |
atc----tttattataactattcaaaaatgagtagtgtactttgtcaagatcaacaaaagcttctcctttctctcaaaaagtctctcactctaagggaca |
348 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30385324 |
atctttatttattataactattcaaaaatgagtagtgtactttgtcaagatcaacaaaagcttctcctttctctcaaaaagtctctcactctaagggaca |
30385423 |
T |
 |
| Q |
349 |
ctatcatg |
356 |
Q |
| |
|
|||||||| |
|
|
| T |
30385424 |
ctatcatg |
30385431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 11 - 122
Target Start/End: Original strand, 30385087 - 30385198
Alignment:
| Q |
11 |
cataggcaaaccagatgactgcaatgaattgtgaaactgccacataccctcttttgcatgctcacaccaaatactatgtagccacgcacacttatatccc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30385087 |
cataggcaaaccagatgactgcaatgaattgtgaaactgccacataccctcttttgcatgctcacaccaaatactatgcagccacgcacacttatatccc |
30385186 |
T |
 |
| Q |
111 |
ataaaacccatt |
122 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30385187 |
ataaaacccatt |
30385198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University