View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16931_high_40 (Length: 297)
Name: NF16931_high_40
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16931_high_40 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 9 - 280
Target Start/End: Original strand, 52373291 - 52373562
Alignment:
| Q |
9 |
agcagagaattgtacctttgtttcaactgcatggagatatgacgaagaaacttttccaactcataaaaagcttttgccagttgcaaggcttgaggaacaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373291 |
agcagagaattgtacctttgtttcaactgcatggagatatgacgaagaaacttttccaactcataaaaagcttttgccagttgcaaggcttgaggaacaa |
52373390 |
T |
 |
| Q |
109 |
gaagacatggacatcatggttgttaatgaagaaacacttgaagctgttgaagatggtgttgaaggagaaatttgggtttcatctccaagtaatgcctctg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373391 |
gaagacatggacatcatggttgttaatgaagaaacacttgaagctgttgaagatggtgttgaaggagaaatttgggtttcatctccaagtaatgcctctg |
52373490 |
T |
 |
| Q |
209 |
gttaccttggtcacccttctttaacaagagaagtttttcatgcaagaatcagaaacacagttcgtaagtgtt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52373491 |
gttaccttggtcacccttctttaacaagagaagtttttcatgcaagaatcagaaacacagttcgtaagtgtt |
52373562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University