View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16931_high_55 (Length: 233)
Name: NF16931_high_55
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16931_high_55 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 86; Significance: 3e-41; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 19 - 116
Target Start/End: Complemental strand, 48240776 - 48240679
Alignment:
| Q |
19 |
aaaatgtcaaaattgtaagatcagacgttatgattggagttcaaacccaacatttacttatgtgtatgaatatataatgtccttgtaatttcatctat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48240776 |
aaaatgtcaaaattgtaagatcagacgttatgatcggagtttaaatccaacatttacttatgtgtatgaatatataatgtccttgtaatttcatctat |
48240679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 53
Target Start/End: Complemental strand, 9174723 - 9174689
Alignment:
| Q |
19 |
aaaatgtcaaaattgtaagatcagacgttatgatt |
53 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |
|
|
| T |
9174723 |
aaaatgtcaaaattgttagatcagacgttatgatt |
9174689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University