View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16931_low_11 (Length: 566)
Name: NF16931_low_11
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16931_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 251; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 18 - 405
Target Start/End: Original strand, 28054219 - 28054592
Alignment:
| Q |
18 |
cttttctctggaaattgcctaggaaaaaagtaagttgctctgtgaggcattctccttttctttcttgttgagagtttcacaaaataaccgtgatgatctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054219 |
cttttctctggaaattgcctaggaaaaaagtaagttgctctgtgaggcattc--cttttctttcttgttgagagtttcacaaaataaccgtgatgatctc |
28054316 |
T |
 |
| Q |
118 |
taactgnnnnnnnnn----aaccaccaacccaaacgaacctgcacttgcaattacaaacgatatcgcttgttaatttgcacgtacacacgtgcgaatcac |
213 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054317 |
taactgtttttttttttttaaccaccaacccaaacgaacctgcacttgcaattacaaacaatctcgcttgttaatttgcacgtacacacgtgcgaatcac |
28054416 |
T |
 |
| Q |
214 |
ttttctccgtcgtcgtcgtcgccgtctccgttactcagctcaatatcccgaataacaatcaccggttgctttgctggctggcttcacctctaacgataac |
313 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054417 |
ttttctc---cgtcgtcgtcgccgtctccgttactcagctcaatatcccgaataacaatcaccggttgctttgctggctggcttcacc------------ |
28054501 |
T |
 |
| Q |
314 |
tatatataaccgccgtgaatgagtttctgtt---tgatgaaacagaaattgcatgcaccaagctagcttgagaaggtggtagttgcaatactcta |
405 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054502 |
----tataaccgccgtgaatgagtttctgtttgatgatgaaacagaaattgcatgcaccaagctagcttgagaaggtggtagttgcaatactcta |
28054592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 442 - 482
Target Start/End: Original strand, 28054625 - 28054665
Alignment:
| Q |
442 |
cccaccgagttgggaaatctgcttctaaggcggtggaaaat |
482 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28054625 |
cccaccgagttgggaaatctgcttctaaggcggtggaaaat |
28054665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University