View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16931_low_41 (Length: 311)
Name: NF16931_low_41
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16931_low_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 114 - 300
Target Start/End: Original strand, 6974130 - 6974314
Alignment:
| Q |
114 |
gatctggtcaccaatgatgtaaataaaaaattgtaactaaa-tgttttgctttcaatcaataataagaaaataactttaactttacaataatctatctga |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6974130 |
gatctggtcaccaatgatgtaaatcaaaa-ttgtaactaaaatgttttgctttcaatcaataataagaaaataactttaactttacaataatctatctga |
6974228 |
T |
|
| Q |
213 |
acctacttataaactaaaactgaaaatattttgtacatatattgtattctacttctagtaagttgttctaaatatttaaaatattcat |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6974229 |
acctacttataaactaaaactgaaaatattttgtacatatattgtattctact--aagtaagttgttctaaatatttaaaatattcat |
6974314 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University