View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16931_low_55 (Length: 251)
Name: NF16931_low_55
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16931_low_55 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 16 - 157
Target Start/End: Original strand, 35327021 - 35327162
Alignment:
| Q |
16 |
cataaacaacaccttgaacagctataaagcttctagggaggggagtaggatgcaatggtgggtgtgctggagcaggtgggtgtaatggagggtgagttgg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35327021 |
cataaacaacaccttgaacagctataaagcttctagggaggggagtaggatgcaatggtgggtgtgctggagcaggtgggtgtaatggagggtgagttgg |
35327120 |
T |
|
| Q |
116 |
aacaacaggggtgtgaacaggtgggtgtagtggtggatgtgc |
157 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35327121 |
aacaacaggggtgtgaacgggtgggtgtagtggtggatgtgc |
35327162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 16 - 52
Target Start/End: Original strand, 35335085 - 35335121
Alignment:
| Q |
16 |
cataaacaacaccttgaacagctataaagcttctagg |
52 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35335085 |
cataaacaacaccttgaacagctattaagcttctagg |
35335121 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University