View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16931_low_56 (Length: 243)
Name: NF16931_low_56
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16931_low_56 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 17 - 89
Target Start/End: Original strand, 41469227 - 41469299
Alignment:
| Q |
17 |
aatttttgtactccattcacattgaaaataaaggacgctttgttttgaaagcgtttcttcttctcttcatctt |
89 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
41469227 |
aatttttgtactccattcacattgaaaataaaggacgctttgttttgaaagtgtttcttcttctcttcatctt |
41469299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University