View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16931_low_57 (Length: 243)
Name: NF16931_low_57
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16931_low_57 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 55288723 - 55288513
Alignment:
| Q |
18 |
aaagaggcgctagatggcacaacaccattacaccaccc-gcgaaccgtgaagaccaatttctaggaatcattttcaatttatcaaattaggaaggcaacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55288723 |
aaagaggcgctagatggcacaacaccattacaccaccccgcgaaccgtgaagaccaatttctaggaatcattttaaatttatcaaattaggaaggcaacc |
55288624 |
T |
|
| Q |
117 |
aaacactgcagtaaagcctttttgccggcacaacctgttaatgtagctatattacatgattcactaaatctaaatcttgccgaaattgcatctatgttta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
55288623 |
aaacactgcagtaaagcctttttgccggcacaacctgttaatgtagctatattacatgattcactaa------atcttgccgaaattgcatctatgttta |
55288530 |
T |
|
| Q |
217 |
gtaaagtcgagcctatg |
233 |
Q |
| |
|
|||||||| |||||||| |
|
|
| T |
55288529 |
gtaaagtcaagcctatg |
55288513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University