View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16931_low_57 (Length: 243)

Name: NF16931_low_57
Description: NF16931
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16931_low_57
NF16931_low_57
[»] chr3 (1 HSPs)
chr3 (18-233)||(55288513-55288723)


Alignment Details
Target: chr3 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 18 - 233
Target Start/End: Complemental strand, 55288723 - 55288513
Alignment:
18 aaagaggcgctagatggcacaacaccattacaccaccc-gcgaaccgtgaagaccaatttctaggaatcattttcaatttatcaaattaggaaggcaacc 116  Q
    |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||    
55288723 aaagaggcgctagatggcacaacaccattacaccaccccgcgaaccgtgaagaccaatttctaggaatcattttaaatttatcaaattaggaaggcaacc 55288624  T
117 aaacactgcagtaaagcctttttgccggcacaacctgttaatgtagctatattacatgattcactaaatctaaatcttgccgaaattgcatctatgttta 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||    
55288623 aaacactgcagtaaagcctttttgccggcacaacctgttaatgtagctatattacatgattcactaa------atcttgccgaaattgcatctatgttta 55288530  T
217 gtaaagtcgagcctatg 233  Q
    |||||||| ||||||||    
55288529 gtaaagtcaagcctatg 55288513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University